ella system Search Results


95
CellCarta proteomics assay development
Proteomics Assay Development, supplied by CellCarta, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/proteomics assay development/product/CellCarta
Average 95 stars, based on 1 article reviews
proteomics assay development - by Bioz Stars, 2026-06
95/100 stars
  Buy from Supplier

99
KCAS Bioanalytical and Biomarker Services kcas bio analytical
Kcas Bio Analytical, supplied by KCAS Bioanalytical and Biomarker Services, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kcas bio analytical/product/KCAS Bioanalytical and Biomarker Services
Average 99 stars, based on 1 article reviews
kcas bio analytical - by Bioz Stars, 2026-06
99/100 stars
  Buy from Supplier

97
Protein Simple Inc ella automated immunoassay system
Ella Automated Immunoassay System, supplied by Protein Simple Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ella automated immunoassay system/product/Protein Simple Inc
Average 97 stars, based on 1 article reviews
ella automated immunoassay system - by Bioz Stars, 2026-06
97/100 stars
  Buy from Supplier

90
Ella Biotech GmbH hplc
Hplc, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hplc/product/Ella Biotech GmbH
Average 90 stars, based on 1 article reviews
hplc - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ella Biotech GmbH anti-htnfa aptamer
Anti Htnfa Aptamer, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-htnfa aptamer/product/Ella Biotech GmbH
Average 90 stars, based on 1 article reviews
anti-htnfa aptamer - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Chemie GmbH ella protothecoides
Ella Protothecoides, supplied by Chemie GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ella protothecoides/product/Chemie GmbH
Average 90 stars, based on 1 article reviews
ella protothecoides - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ella Biotech GmbH index primers
Index Primers, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/index primers/product/Ella Biotech GmbH
Average 90 stars, based on 1 article reviews
index primers - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ella Biotech GmbH forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27)
Forward Primer 5′ Gctgtgtgactcctgcaa 3′ (Seq Id No: 27), supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27)/product/Ella Biotech GmbH
Average 90 stars, based on 1 article reviews
forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ella Biotech GmbH mirna-155 or mirna-21 specific dna probe
Mirna 155 Or Mirna 21 Specific Dna Probe, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mirna-155 or mirna-21 specific dna probe/product/Ella Biotech GmbH
Average 90 stars, based on 1 article reviews
mirna-155 or mirna-21 specific dna probe - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ella Biotech GmbH tnf-α (sense: cttctgtctactgaacttcgg, anti-sense: gtgcttgatctgt-tgtttcc)
Tnf α (Sense: Cttctgtctactgaacttcgg, Anti Sense: Gtgcttgatctgt Tgtttcc), supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tnf-α (sense: cttctgtctactgaacttcgg, anti-sense: gtgcttgatctgt-tgtttcc)/product/Ella Biotech GmbH
Average 90 stars, based on 1 article reviews
tnf-α (sense: cttctgtctactgaacttcgg, anti-sense: gtgcttgatctgt-tgtttcc) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

90
Ella Biotech GmbH gapdh (gapdh sense: accacagtccatgccatcac, anti-sense: tccaccaccctgttgctgta)
Gapdh (Gapdh Sense: Accacagtccatgccatcac, Anti Sense: Tccaccaccctgttgctgta), supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gapdh (gapdh sense: accacagtccatgccatcac, anti-sense: tccaccaccctgttgctgta)/product/Ella Biotech GmbH
Average 90 stars, based on 1 article reviews
gapdh (gapdh sense: accacagtccatgccatcac, anti-sense: tccaccaccctgttgctgta) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results