95
|
CellCarta
proteomics assay development Proteomics Assay Development, supplied by CellCarta, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/proteomics assay development/product/CellCarta Average 95 stars, based on 1 article reviews
proteomics assay development - by Bioz Stars,
2026-06
95/100 stars
|
Buy from Supplier |
99
|
KCAS Bioanalytical and Biomarker Services
kcas bio analytical Kcas Bio Analytical, supplied by KCAS Bioanalytical and Biomarker Services, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kcas bio analytical/product/KCAS Bioanalytical and Biomarker Services Average 99 stars, based on 1 article reviews
kcas bio analytical - by Bioz Stars,
2026-06
99/100 stars
|
Buy from Supplier |
97
|
Protein Simple Inc
ella automated immunoassay system Ella Automated Immunoassay System, supplied by Protein Simple Inc, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ella automated immunoassay system/product/Protein Simple Inc Average 97 stars, based on 1 article reviews
ella automated immunoassay system - by Bioz Stars,
2026-06
97/100 stars
|
Buy from Supplier |
90
|
Ella Biotech GmbH
hplc Hplc, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hplc/product/Ella Biotech GmbH Average 90 stars, based on 1 article reviews
hplc - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ella Biotech GmbH
anti-htnfa aptamer Anti Htnfa Aptamer, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-htnfa aptamer/product/Ella Biotech GmbH Average 90 stars, based on 1 article reviews
anti-htnfa aptamer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Chemie GmbH
ella protothecoides Ella Protothecoides, supplied by Chemie GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ella protothecoides/product/Chemie GmbH Average 90 stars, based on 1 article reviews
ella protothecoides - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ella Biotech GmbH
index primers Index Primers, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/index primers/product/Ella Biotech GmbH Average 90 stars, based on 1 article reviews
index primers - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ella Biotech GmbH
forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27) Forward Primer 5′ Gctgtgtgactcctgcaa 3′ (Seq Id No: 27), supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27)/product/Ella Biotech GmbH Average 90 stars, based on 1 article reviews
forward primer 5′-gctgtgtgactcctgcaa-3′ (seq id no: 27) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ella Biotech GmbH
mirna-155 or mirna-21 specific dna probe Mirna 155 Or Mirna 21 Specific Dna Probe, supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mirna-155 or mirna-21 specific dna probe/product/Ella Biotech GmbH Average 90 stars, based on 1 article reviews
mirna-155 or mirna-21 specific dna probe - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ella Biotech GmbH
tnf-α (sense: cttctgtctactgaacttcgg, anti-sense: gtgcttgatctgt-tgtttcc) Tnf α (Sense: Cttctgtctactgaacttcgg, Anti Sense: Gtgcttgatctgt Tgtttcc), supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tnf-α (sense: cttctgtctactgaacttcgg, anti-sense: gtgcttgatctgt-tgtttcc)/product/Ella Biotech GmbH Average 90 stars, based on 1 article reviews
tnf-α (sense: cttctgtctactgaacttcgg, anti-sense: gtgcttgatctgt-tgtttcc) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Ella Biotech GmbH
gapdh (gapdh sense: accacagtccatgccatcac, anti-sense: tccaccaccctgttgctgta) Gapdh (Gapdh Sense: Accacagtccatgccatcac, Anti Sense: Tccaccaccctgttgctgta), supplied by Ella Biotech GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gapdh (gapdh sense: accacagtccatgccatcac, anti-sense: tccaccaccctgttgctgta)/product/Ella Biotech GmbH Average 90 stars, based on 1 article reviews
gapdh (gapdh sense: accacagtccatgccatcac, anti-sense: tccaccaccctgttgctgta) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |